# score_guides Add **on-target** activity and **off-target** specificity columns to a guide BED. On-target defaults to RuleSet3 (`--tracr`); add deep models with `--cas9_scorer` / `--cas12a_scorer`. Off-target specificity comes from each `-i` index (engine auto-detected). ```bash crisprware score_guides -b chrIII_sequence_gRNA/chrIII_sequence_gRNA.bed \ -i chrIII_sequence_crisprots/chrIII_sequence_crisprots --tracr Chen2013 --threads 8 ``` ```text #chr start stop context strand sequence RS3_score_Chen2013 specificity_chrIII_sequence_crisprots chrIII 10569 10589 GCTGCCTACATGTACTTTTATTTGAGGGTC + CCTACATGTACTTTTATTTG -1.4272 1.0 chrIII 10590 10610 TTGAGGGTCCCCATGATCTTGAAGAGGAGA + GGGTCCCCATGATCTTGAAG -0.0695 1.0 ``` One output column per scorer and per index. RuleSet3 is a z-score (centered at 0); specificity is 0-1 (1.0 = no off-targets). ## Options you reach for - **On-target**: `--tracr Hsu2013|Chen2013|both` (RuleSet3); `--cas9_scorer deepspcas9 deephf_wt_u6 ...` or `--cas12a_scorer deepcpf1 enpam_gb ...` (`--cas12a_variant ` for the per-variant model). Multiple values allowed, one column each. See the on-target and off-target scoring pages for the menu. - **Off-target**: one or more `-i` indices (crispr-ots and/or guidescan2); `--mismatches`, `--threshold` (discard guides with an off-target within this many mismatches), and -- guidescan2 only -- `--rna_bulges` / `--dna_bulges`. - **Speed / memory**: `--threads`, `--chunk_size` (guides held in memory at once), `--skip_rs3`, `--skip_gs2`, `--min_` (drop low scorers before the off-target pass). - **Genome-wide Cas12a track**: `--ucscgb ` writes a UCSC Genome Browser Cas12a track instead of a scored BED (see the Cas12a UCSC tracks section).