# Quickstart The whole pipeline on the bundled *C. elegans* chrIII test data (`tests/test_data/ce11/`): build gene models, index the genome, find guides in coding sequence, score them, and pick the best per gene. Each step is one `crisprware` subcommand; the per-module pages cover the options. ## 1. Gene models ```bash crisprware preprocess_annotation -g tests/test_data/ce11/chrIII_ce11.ncbiRefSeq.gtf \ -m metagene consensus longest shortest ``` Collapses multi-isoform genes into four model GTFs (pick one for the steps below): ```text chrIII_ce11.ncbiRefSeq/ chrIII_ce11.ncbiRefSeq_consensus.gtf chrIII_ce11.ncbiRefSeq_longestCDS.gtf chrIII_ce11.ncbiRefSeq_meta.gtf chrIII_ce11.ncbiRefSeq_shortestCDS.gtf ``` ## 2. Off-target index ```bash crisprware index_genome -f tests/test_data/ce11/chrIII_sequence.fasta -p NGG -l 20 ``` Builds the `crispr-ots` off-target index into `chrIII_sequence_crisprots/` (the `.crot` mmap database). ## 3. Generate guides ```bash crisprware generate_guides -f tests/test_data/ce11/chrIII_sequence.fasta \ -k tests/test_data/ce11/chrIII_ce11.ncbiRefSeq.gtf --feature CDS ``` Every NGG protospacer whose cut site lands in a CDS -> `chrIII_sequence_gRNA/chrIII_sequence_gRNA.bed` (312,925 guides): ```text #chr start stop id,sequence,pam,chromosome,position,sense context strand chrIII 1482 1502 chrIII:1483:+,GGAATGTACTTCTTCCCAAA,NGG,chrIII,1483,+ TGTTGGAATGTACTTCTTCCCAAAAGGTTC + ``` ## 4. Score guides ```bash crisprware score_guides -b chrIII_sequence_gRNA/chrIII_sequence_gRNA.bed \ -i chrIII_sequence_crisprots/chrIII_sequence_crisprots --tracr Chen2013 --threads 8 ``` Adds an RS3 on-target column and a `crispr-ots` off-target specificity column (the engine is auto-detected from the index) -> `chrIII_sequence_scoredgRNA/...bed`: ```text #chr start stop context strand sequence RS3_score_Chen2013 specificity_chrIII_sequence_crisprots chrIII 10569 10589 GCTGCCTACATGTACTTTTATTTGAGGGTC + CCTACATGTACTTTTATTTG -1.4272 1.0 chrIII 10590 10610 TTGAGGGTCCCCATGATCTTGAAGAGGAGA + GGGTCCCCATGATCTTGAAG -0.0695 1.0 ``` RS3 is a z-score (centered at 0); specificity is 0-1 (1.0 = no off-targets). ## 5. Rank guides ```bash crisprware rank_guides -k chrIII_sequence_scoredgRNA/...bed \ -t tests/test_data/ce11/chrIII_ce11.ncbiRefSeq.gtf -f CDS \ -c RS3_score_Chen2013 specificity_chrIII_sequence_crisprots -m 0 0.2 -p 5 65 \ -r RS3_score_Chen2013 --output_all ``` Keeps guides with RS3 >= 0, specificity >= 0.2, in the 5th-65th CDS percentile, ranks by RS3, and returns the picks per gene -> `..._rankedgRNA/...bed`: ```text #chr start stop strand sequence RS3_score_Chen2013 specificity_... target_id RS3_..._normalized combined_weighted chrIII 574162 574182 + TAAGCTTAGTACTTATGAGG 0.9041 1.0 B0353.1 0.8819 0.8819 ```