rank_guides

Filter scored guides, then select and rank the best few per target (gene, transcript, or BED interval).

crisprware rank_guides -k chrIII_sequence_scoredgRNA/chrIII_sequence_scoredgRNA.bed \
  -t tests/test_data/ce11/chrIII_ce11.ncbiRefSeq.gtf -f CDS \
  -c RS3_score_Chen2013 specificity_chrIII_sequence_crisprots -m 0 0.2 -p 5 65 \
  -r RS3_score_Chen2013 --output_all

Keeps guides with RS3 >= 0 and specificity >= 0.2, in the 5th-65th CDS percentile, ranks them by RS3, and returns the picks per gene -> ..._rankedgRNA/...bed:

#chr   start   stop    strand sequence             RS3_score_Chen2013  specificity_...  target_id  RS3_..._normalized  combined_weighted
chrIII 574162  574182  +      TAAGCTTAGTACTTATGAGG 0.9041              1.0              B0353.1    0.8819              0.8819

Options you reach for

Targets: -t <gtf/bed>; for GTF/GFF set --target_mode gene|tx and -f/--feature CDS (or exon, 5UTR, …). -n/--number_of_guides per target, --min_spacing between picks.
Filter (-c columns paired with -m minimums): e.g. -c RS3_score_Chen2013 specificity_idx -m 0 0.2. -p/--percentile_range lo hi restricts position within the feature.
Rank (-r columns, optional -w/--column_weights): combined into a weighted score; --normalize_columns scales each to 0-1 first.
--output_all / --plot_histogram – write the intermediate TSV (and histograms) at each filter stage, useful for tuning thresholds.

Note

-c/-m and -r/-w are positional pairs – the order of columns must match the order of values.