The bigBed columns
cas12a.bb is bed9+14 = 23 fields, one row per guide, defined by cas12aTargets.as. A real row
(hg38, chr1:1000166):
chrom chr1
chromStart 1000166 0-based start of the 27-nt PAM+spacer site
chromEnd 1000193 chromStart + 27
name (blank)
score 96 drives the browser score filter (see below)
strand +
thickStart 1000170 spacer start (chromStart + 4); the thin 4 nt is the PAM
thickEnd 1000193
itemRgb 0,200,0 display color (see below)
guideSeq CCACACTCGCCCCAGCCAATCGA 23-nt spacer
pam TTTC 4-nt PAM
unique_TTTV True no identical protospacer elsewhere at a TTTV PAM
unique_TTTN True ... at a TTTN PAM
TTTV_enCas12a_specificity 90% (0.9377)
TTTN_enCas12a_specificity 85% (0.7001)
TTTV_AsCas12a_specificity 89% (0.9958)
TTTN_AsCas12a_specificity 87% (0.9628)
ascas12a_deepcpf1_score 96% (0.8212)
enseq_deepcpf1_score 61% (0.6454)
deepcpf1_score 57% (53.5321)
enpam_gb_score 19% (0.7867)
_mouseOver EnCas12a Spec: 85, AsCas12a Spec: 87, EnCas12a-DeepCpf1: 61, ...
_offset 27614949 byte offset into crisprDetails.tab (0 = no list)
The eight score columns read percentile (raw)
percentile ranked within the guide’s chunk.
raw is exact and global: specificity on 0-1 (
1.0= no off-targets); DeepCpf1 is the exception, its native output is ~0-100.
Four off-target specificity columns = {enCas12a, AsCas12a} x {scanned vs the TTTV, TTTN index}. Four on-target efficiency columns = AsCas12a-DeepCpf1, EnCas12a-DeepCpf1, DeepCpf1, EnPAM-GB.
score and color
score (field 5, 0-1000):
round(AsCas12a TTTN specificity_raw x 100), e.g.0.9628 -> 96. The browser’s score filter is therefore a specificity filter.itemRgb (field 9): ramps on the AsCas12a-DeepCpf1 percentile, green
>75, yellow>50, red<=50; overridden to grey for low specificity, then 1/2-mismatch, then non-unique. The row above is green because AsCas12a-DeepCpf1 = 96%.
Warning
Percentiles are per-chunk (see the scoring step), so score,
itemRgb, and the NN% are ranked within a chunk, not genome-wide. The parenthesized raw values are
exact and comparable across the whole genome.