The bigBed columns

cas12a.bb is bed9+14 = 23 fields, one row per guide, defined by cas12aTargets.as. A real row (hg38, chr1:1000166):

chrom        chr1
chromStart   1000166                    0-based start of the 27-nt PAM+spacer site
chromEnd     1000193                    chromStart + 27
name         (blank)
score        96                         drives the browser score filter (see below)
strand       +
thickStart   1000170                    spacer start (chromStart + 4); the thin 4 nt is the PAM
thickEnd     1000193
itemRgb      0,200,0                    display color (see below)
guideSeq     CCACACTCGCCCCAGCCAATCGA    23-nt spacer
pam          TTTC                       4-nt PAM
unique_TTTV  True                       no identical protospacer elsewhere at a TTTV PAM
unique_TTTN  True                       ... at a TTTN PAM
TTTV_enCas12a_specificity   90% (0.9377)
TTTN_enCas12a_specificity   85% (0.7001)
TTTV_AsCas12a_specificity   89% (0.9958)
TTTN_AsCas12a_specificity   87% (0.9628)
ascas12a_deepcpf1_score     96% (0.8212)
enseq_deepcpf1_score        61% (0.6454)
deepcpf1_score              57% (53.5321)
enpam_gb_score              19% (0.7867)
_mouseOver   EnCas12a Spec: 85, AsCas12a Spec: 87, EnCas12a-DeepCpf1: 61, ...
_offset      27614949                   byte offset into crisprDetails.tab (0 = no list)

The eight score columns read percentile (raw)

  • percentile ranked within the guide’s chunk.

  • raw is exact and global: specificity on 0-1 (1.0 = no off-targets); DeepCpf1 is the exception, its native output is ~0-100.

Four off-target specificity columns = {enCas12a, AsCas12a} x {scanned vs the TTTV, TTTN index}. Four on-target efficiency columns = AsCas12a-DeepCpf1, EnCas12a-DeepCpf1, DeepCpf1, EnPAM-GB.

score and color

  • score (field 5, 0-1000): round(AsCas12a TTTN specificity_raw x 100), e.g. 0.9628 -> 96. The browser’s score filter is therefore a specificity filter.

  • itemRgb (field 9): ramps on the AsCas12a-DeepCpf1 percentile, green >75, yellow >50, red <=50; overridden to grey for low specificity, then 1/2-mismatch, then non-unique. The row above is green because AsCas12a-DeepCpf1 = 96%.

Warning

Percentiles are per-chunk (see the scoring step), so score, itemRgb, and the NN% are ranked within a chunk, not genome-wide. The parenthesized raw values are exact and comparable across the whole genome.